Getting Over The Code Delusion: On the demise of DNA as destiny
September 16, 2012
When it emerged a few years ago that humans and chimpanzees shared, by some measures, 98 or 99 percent of their DNA, a good deal of verbal hand-wringing and chest-beating ensued. How could we hold our heads up with high-browed, post-simian dignity when, as the New Scientist reported in 2003, “chimps are human”? If the DNA of the two species is nearly the same, and if, as most everyone seemed to believe, DNA is destiny, what remained to make us special?
Such was the fretting on the human side, anyway. To be truthful, the chimps didn’t seem much interested. And their disinterest, it turns out, was far more fitting than our angst.
In 1992, Nobel prize-winning geneticist Walter Gilbert wrote that you and I will one day hold up a CD containing our DNA sequence and say, “Here is a human being; it’s me!” His essay was entitled “A Vision of the Grail.” Today one can only wonder how we became so invested in the almost sacred importance of an abstract and one-dimensional genetic code — a code so thinly connected to the full-fleshed reality of our selves that its entire import could be captured in a skeletal string of four repeating letters, like so:
ATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGCAATG
It’s true that the code, as it was understood at the height of the genomic era, had some grounding in material reality. Each of the four different letters stands for one of the four nucleotide bases constituting the DNA sequence. And each group of three successive letters (referred to as a “codon”) potentially represents an amino acid, a constituent of protein. The idea was that the bases in a protein-coding DNA sequence, or gene, led to the synthesis of the corresponding sequence of amino acids in a protein. And proteins, folded into innumerable shapes, play a decisive role in virtually all living processes. By specifying the production of proteins, genes were presumed to be bearers of the blueprint, or master program, or molecular instruction book of our lives. As Richard Dawkins summed up in his 1986 book The Blind Watchmaker:
There is a sense, therefore, in which the three-dimensional coiled shape of a protein is determined by the one-dimensional sequence of code symbols in the DNA…. The whole translation, from strictly sequential DNA ROM [read-only memory] to precisely invariant three-dimensional protein shape, is a remarkable feat of digital information technology.
Certainly the idea of a master program seemed powerful to those who were enamored of it. In their enthusiasm they heralded one revolutionary gene discovery after another — a gene for cystic fibrosis (from which the string of letters above is excerpted), a gene for cancer, a gene for obesity, a gene for depression, a gene for alcoholism, a gene for sexual preference. Building block by building block, genetics was going to show how a living organism could be constructed from mindless, indifferent matter.
And yet the most striking thing about the genomic revolution is that the revolution never happened. Yes, it’s been an era of the most amazing technical achievement, marked by an overwhelming flood of new data. It’s true that we are gaining, even if largely by trial and error, certain manipulative powers. But our understanding of the integrity and unified functioning of the living cell has, if anything, been more obscured than illumined by the torrent of data. “Many of us in the genetics community,” write Linda and Edward McCabe in DNA: Promise and Peril (2008), “sincerely believed that DNA analysis would provide us with a molecular crystal ball that would allow us to know quite accurately the clinical futures of our individual patients.” Unfortunately, as they and many others now acknowledge, the reality did not prove so straightforward.
As minor tokens of the changing consciousness among biologists, one could cite recent articles in the world’s two premier scientific journals, each reflecting upon the 1989 discovery of the “gene for cystic fibrosis.” “The Promise of a Cure: 20 Years and Counting” — so ran the headline in Science, followed by this slightly sarcastic gloss: “The discovery of the cystic fibrosis gene brought big hopes for gene-based medicine; although a lot has been achieved over two decades, the payoff remains just around the corner.” An echo quickly came from Nature, without the sarcasm: “One Gene, Twenty Years: When the cystic fibrosis gene was found in 1989, therapy seemed around the corner. Two decades on, biologists still have a long way to go.”
The story has been repeated for one gene after another, which may be why molecular biologist Tom Misteli offered such a startling postscript to the unbounded optimism of the Human Genome Project. “Comparative genome analysis and large-scale mapping of genome features,” he wrote in the journalCell, “shed little light onto the Holy Grail of genome biology, namely the question of how genomes actually work in vivo” (that is, in living organisms).
But is this surprising? The human body is not a mere implication of clean logical code in abstract conceptual space, but rather a play of complexly shaped and intricately interacting physical substances and forces. Yet the four genetic letters, in the researcher’s mind, became curiously detached from their material matrix. In many scientific discussions it hardly would have mattered whether the letters of the “Book of Life” represented nucleotide bases or completely different molecular combinations. All that counted were certain logical correspondences between code and protein together with a few bits of regulatory logic, all buttressed by the massive weight of an unsupported assumption: somehow, by neatly executing an immaculate, computer-like DNA logic, the organism would fulfill its destiny as a living creature. The details could be worked out later.
The misdirection in all this badly needs elaborating — a task I hope to advance here. As for the differences between humans and chimpanzees, the only wonder is that so many were so exercised by it. If we had wanted to compare ourselves to chimps, we could have done the obvious and direct and scientifically respectable thing: we could have observed ourselves and chimps, noting the similarities and differences. Not such a strange notion, really — unless one is so transfixed by a code abstracted from human and chimp that one comes to prefer it to the organisms themselves.
I’m not aware of any pundit who, brought back to reality from the realm of code-fixated cerebration, would have been so confused about the genetic comparison as to invite a chimp home for dinner to discuss world politics. If we had been looking to ground our levitated theory in scientific observation, we would have known that the proper response to the code similarity in humans and chimps was: “Well, so much for the central, determining role we’ve been assigning to our genes.”
The central truth arising from genetic research today is that the hope of finding an adequate explanation of life in terms of inanimate, molecular-level machinery was misconceived. Just as we witness the distinctive character of life when we observe the organism as a whole, so, too, we encounter that same living character when we analyze the organism down to the level of molecules and genes. One by one every seemingly reliable and predictable “molecular mechanism” has been caught deviating from its “program” and submitting instead to the fluid life of its larger context. And chief among the deviants is that supposed First Cause, the gene itself. We are progressing into a post-genomic era — the new era of epigenetics…
